Computer Science Canada The Greatest Online Mind-bender |
| Author: | TheZsterBunny [ Sun Mar 27, 2005 11:45 pm ] |
| Post subject: | The Greatest Online Mind-bender |
http://deathball.net/notpron/ It's strange, but addicting. I'm at level 7, and I think I've almost got it. lemme know how you do. ^_^ -Z |
|
| Author: | rizzix [ Mon Mar 28, 2005 12:31 am ] |
| Post subject: | |
ha. stuck on 4. i dont get it. edit: ok so ti kinda works in IE (not firefox) but still i seriouly dont know that one. what is it? this is messed it expects a good GK (general knowledge) |
|
| Author: | Pickles [ Mon Mar 28, 2005 1:58 am ] |
| Post subject: | |
well its credibility is shot right off the bat by claiming its "not pr0n" |
|
| Author: | Amailer [ Mon Mar 28, 2005 9:21 am ] |
| Post subject: | |
uh... right sry btw im at lvl 8 |
|
| Author: | TheZsterBunny [ Mon Mar 28, 2005 9:58 am ] |
| Post subject: | |
Amailer, Bad! please remove that quote. this was to inform, not to cheat. Quote: if you read the bottom of the page, you'll see further instructions
-Z |
|
| Author: | Mazer [ Mon Mar 28, 2005 10:31 am ] |
| Post subject: | |
This is really cool! Thanks for the link, Zster. I'm on level 9 at the moment, 8 was interesting. |
|
| Author: | rizzix [ Mon Mar 28, 2005 5:26 pm ] |
| Post subject: | |
whats that candy? |
|
| Author: | Amailer [ Mon Mar 28, 2005 5:34 pm ] |
| Post subject: | |
What the hell is level 10? Nothing is making sense... level 9 was weird...still is.... |
|
| Author: | MihaiG [ Mon Mar 28, 2005 7:35 pm ] |
| Post subject: | |
im stuck on4 i got the username and pass but it wont do anything |
|
| Author: | Mazer [ Mon Mar 28, 2005 9:21 pm ] |
| Post subject: | |
It took me a bit to get the candy. They tell you that you can see the last letter in it's name reflected in the mirror but that's got to be among the shittiest quality of images I've ever come across on the internet. After a while of looking around with some worthless clues (seriously, sometimes they don't even seem to be related) I just took a wild guess and went with that. I'd rather not post spoilers, but if anyone thinks I can be of assistance, send me a PM or find me on msn as the case may be. I got to level 13 this morning before I had to go to class. |
|
| Author: | Amailer [ Mon Mar 28, 2005 11:03 pm ] |
| Post subject: | |
Any tips in level 10? I don't get it but I think it has to do something with level 8s user/pass. |
|
| Author: | [Gandalf] [ Mon Mar 28, 2005 11:39 pm ] |
| Post subject: | |
I dont get it, I'm stuck on 4 too... Does it require a password cracker or something? Me is confused *edit* hmm, wait, wait I think I might have it - just let me test this thing... *edit 2* oh yeah! I got it After working away, I got to level 11 - too hard, too much time... |
|
| Author: | Bacchus [ Tue Mar 29, 2005 7:09 am ] |
| Post subject: | |
lol i got stuk on lvl 5, im pretty sure i got the username but when i search the quote i only get 2 german sites and another forum talking about the same thing |
|
| Author: | Amailer [ Tue Mar 29, 2005 8:53 am ] |
| Post subject: | |
Well Im on level 10 but Im not stuck on it...Just that I haven't tried but it seriously doesn't make sense :S |
|
| Author: | Mazer [ Tue Mar 29, 2005 10:11 am ] |
| Post subject: | |
Ugh, level 10. That one was a bit of a bitch. I'll PM you with some hints. EDIT: Spoiler guarded, of course. |
|
| Author: | zylum [ Mon Apr 04, 2005 9:18 pm ] |
| Post subject: | |
level 41 lol... |
|
| Author: | Delos [ Tue Apr 05, 2005 1:48 pm ] |
| Post subject: | |
zylum, stop it. We know you pwn. Now let us mortals be in peace! BTW, still on the 'before it's time' level 11...[sigh] |
|
| Author: | zylum [ Tue Apr 05, 2005 11:54 pm ] |
| Post subject: | |
Delos wrote: zylum, stop it. We know you pwn. Now let us mortals be in peace!
BTW, still on the 'before it's time' level 11...[sigh] lol, the clue is ahead of its time not before... lmfao... what's 'ahead' of its time on that page? try the source. man that one was easy, i mean there are only 2 clues, put one with the other and you have the solution... anybody else need any hints? |
|
| Author: | jamonathin [ Wed Apr 06, 2005 10:28 am ] |
| Post subject: | |
I'll take some |
|
| Author: | Delos [ Wed Apr 06, 2005 1:35 pm ] |
| Post subject: | |
Tackling 16 right now...ha! I'm not a total idiot! But yes, will take a while to catch up to you...if ever... |
|
| Author: | zylum [ Thu Apr 07, 2005 6:06 pm ] |
| Post subject: | |
jamonathin wrote: I'll take some
which level are you on? Delos > yeah 16 is one of the harder ones? what does the url say? what does the source define # to be? |
|
| Author: | zylum [ Fri Apr 08, 2005 11:45 pm ] |
| Post subject: | |
im on 48 now... anybody have any idea what: GTTGCTCTTGAAAATACTATTAATGAA can be translated into??? |
|
| Author: | Tony [ Fri Apr 08, 2005 11:57 pm ] |
| Post subject: | |
zylum wrote: GTTGCTCTTGAAAATACTATTAATGAA
can be translated into??? DNA strand sequence |
|
| Author: | Delos [ Sat Apr 09, 2005 10:21 am ] |
| Post subject: | |
Look for a list of complementary amino acids. Something like "Glu-arg-lyc" etc etc. You'll need to be careful of which end you start transcribing at (you'll need to transcribe first to RNA, then translate to amino acid.) It might be a section from a particular (and bloody small) protein. Or you might need to take the resulting a.a.s and do something w/ them (first/last letter = word?). Who knows... |
|
| Author: | jamonathin [ Sat Apr 09, 2005 12:21 pm ] |
| Post subject: | |
zylum wrote: jamonathin wrote: I'll take some
which level are you on? Delos > yeah 16 is one of the harder ones? what does the url say? what does the source define # to be? uhh, 3 . . . edit - Ah i got it false - true 8) |
|
| Author: | Neo [ Tue Apr 12, 2005 4:54 pm ] |
| Post subject: | |
Stuck on 6. Anyone have any hints to help? |
|
| Author: | Delos [ Tue Apr 12, 2005 9:22 pm ] |
| Post subject: | |
Hmm...lvl 6... Ok, how about this. Do you know Homestarrunner (if not, where have your been hiding these last few years?)? Do you know what Strong Bad always talks about in his Emails Intro screen? Think about it... Edit: BTW, if you're wondering, this is what I'm talking about. |
|
| Author: | Neo [ Wed Apr 13, 2005 3:21 pm ] |
| Post subject: | |
Delos wrote: Hmm...lvl 6...
Ok, how about this. Do you know Homestarrunner (if not, where have your been hiding these last few years?)? Do you know what Strong Bad always talks about in his Emails Intro screen? Think about it... Edit: BTW, if you're wondering, this is what I'm talking about. Never heard of it. Anways I checked out that link and cant make the connection to the few clues i've gatherd in level 6: "ascii is an alternative", "anagram"(dont know if that is a clue) , "ALTernative". I tried running "ascii is an alternative" in an anagram program however didnt get anything useful. |
|
| Author: | Delos [ Wed Apr 13, 2005 5:25 pm ] |
| Post subject: | |
DavidM wrote: The page consists of more than a picture. (In case you're wondering, he's the guy that made NotPron.) Check out the forums if you need more help. |
|