----------------------------------- TheZsterBunny Sun Mar 27, 2005 11:45 pm The Greatest Online Mind-bender ----------------------------------- http://deathball.net/notpron/ It's strange, but addicting. I'm at level 7, and I think I've almost got it. lemme know how you do. ^_^ -Z ----------------------------------- rizzix Mon Mar 28, 2005 12:31 am ----------------------------------- ha. stuck on 4. i dont get it. :? edit: ok so ti kinda works in IE (not firefox) but still i seriouly dont know that one. what is it? this is messed it expects a good GK (general knowledge) ----------------------------------- Pickles Mon Mar 28, 2005 1:58 am ----------------------------------- well its credibility is shot right off the bat by claiming its "not pr0n" ----------------------------------- Amailer Mon Mar 28, 2005 9:21 am ----------------------------------- uh... right sry btw im at lvl 8 ----------------------------------- TheZsterBunny Mon Mar 28, 2005 9:58 am ----------------------------------- Amailer, Bad! please remove that quote. this was to inform, not to cheat. if you read the bottom of the page, you'll see further instructions -Z ----------------------------------- Mazer Mon Mar 28, 2005 10:31 am ----------------------------------- This is really cool! Thanks for the link, Zster. I'm on level 9 at the moment, 8 was interesting. ----------------------------------- rizzix Mon Mar 28, 2005 5:26 pm ----------------------------------- whats that candy? ----------------------------------- Amailer Mon Mar 28, 2005 5:34 pm ----------------------------------- What the hell is level 10? Nothing is making sense... level 9 was weird...still is.... ----------------------------------- MihaiG Mon Mar 28, 2005 7:35 pm ----------------------------------- im stuck on4 i got the username and pass but it wont do anything ----------------------------------- Mazer Mon Mar 28, 2005 9:21 pm ----------------------------------- It took me a bit to get the candy. They tell you that you can see the last letter in it's name reflected in the mirror but that's got to be among the shittiest quality of images I've ever come across on the internet. After a while of looking around with some worthless clues (seriously, sometimes they don't even seem to be related) I just took a wild guess and went with that. I'd rather not post spoilers, but if anyone thinks I can be of assistance, send me a PM or find me on msn as the case may be. I got to level 13 this morning before I had to go to class. ----------------------------------- Amailer Mon Mar 28, 2005 11:03 pm ----------------------------------- Any tips in level 10? I don't get it but I think it has to do something with level 8s user/pass. ----------------------------------- [Gandalf] Mon Mar 28, 2005 11:39 pm ----------------------------------- I dont get it, I'm stuck on 4 too... Does it require a password cracker or something? Me is confused :? :? *edit* hmm, wait, wait I think I might have it - just let me test this thing... *edit 2* oh yeah! I got it :D . It's not impossible! After working away, I got to level 11 - too hard, too much time... ----------------------------------- Bacchus Tue Mar 29, 2005 7:09 am ----------------------------------- lol i got stuk on lvl 5, im pretty sure i got the username but when i search the quote i only get 2 german sites and another forum talking about the same thing ----------------------------------- Amailer Tue Mar 29, 2005 8:53 am ----------------------------------- Well Im on level 10 but Im not stuck on it...Just that I haven't tried but it seriously doesn't make sense :S ----------------------------------- Mazer Tue Mar 29, 2005 10:11 am ----------------------------------- Ugh, level 10. That one was a bit of a bitch. I'll PM you with some hints. EDIT: Spoiler guarded, of course. ----------------------------------- zylum Mon Apr 04, 2005 9:18 pm ----------------------------------- level 41 lol... ----------------------------------- Delos Tue Apr 05, 2005 1:48 pm ----------------------------------- zylum, stop it. We know you pwn. Now let us mortals be in peace! BTW, still on the 'before it's time' level 11... ----------------------------------- zylum Tue Apr 05, 2005 11:54 pm ----------------------------------- zylum, stop it. We know you pwn. Now let us mortals be in peace! BTW, still on the 'before it's time' level 11... lol, the clue is ahead of its time not before... lmfao... what's 'ahead' of its time on that page? try the source. man that one was easy, i mean there are only 2 clues, put one with the other and you have the solution... anybody else need any hints? ----------------------------------- jamonathin Wed Apr 06, 2005 10:28 am ----------------------------------- I'll take some :) ----------------------------------- Delos Wed Apr 06, 2005 1:35 pm ----------------------------------- Tackling 16 right now...ha! I'm not a total idiot! :D But yes, will take a while to catch up to you...if ever... ----------------------------------- zylum Thu Apr 07, 2005 6:06 pm ----------------------------------- I'll take some :) which level are you on? Delos > yeah 16 is one of the harder ones? what does the url say? what does the source define # to be? ----------------------------------- zylum Fri Apr 08, 2005 11:45 pm ----------------------------------- im on 48 now... anybody have any idea what: GTTGCTCTTGAAAATACTATTAATGAA can be translated into??? ----------------------------------- Tony Fri Apr 08, 2005 11:57 pm ----------------------------------- GTTGCTCTTGAAAATACTATTAATGAA can be translated into??? DNA strand sequence ----------------------------------- Delos Sat Apr 09, 2005 10:21 am ----------------------------------- Look for a list of complementary amino acids. Something like "Glu-arg-lyc" etc etc. You'll need to be careful of which end you start transcribing at (you'll need to transcribe first to RNA, then translate to amino acid.) It might be a section from a particular (and bloody small) protein. Or you might need to take the resulting a.a.s and do something w/ them (first/last letter = word?). Who knows... ----------------------------------- jamonathin Sat Apr 09, 2005 12:21 pm ----------------------------------- I'll take some :) which level are you on? Delos > yeah 16 is one of the harder ones? what does the url say? what does the source define # to be? uhh, 3 . . . :roll: edit - Ah i got it false - true 8) ----------------------------------- Neo Tue Apr 12, 2005 4:54 pm ----------------------------------- Stuck on 6. Anyone have any hints to help? ----------------------------------- Delos Tue Apr 12, 2005 9:22 pm ----------------------------------- Hmm...lvl 6... Ok, how about this. Do you know Homestarrunner (if not, where have your been hiding these last few years?)? Do you know what Strong Bad always talks about in his Emails Intro screen? Think about it... Edit: BTW, if you're wondering, ----------------------------------- Neo Wed Apr 13, 2005 3:21 pm ----------------------------------- Hmm...lvl 6... Ok, how about this. Do you know Homestarrunner (if not, where have your been hiding these last few years?)? Do you know what Strong Bad always talks about in his Emails Intro screen? Think about it... Edit: BTW, if you're wondering, Never heard of it. Anways I checked out that link and cant make the connection to the few clues i've gatherd in level 6: "ascii is an alternative", "anagram"(dont know if that is a clue) , "ALTernative". I tried running "ascii is an alternative" in an anagram program however didnt get anything useful. ----------------------------------- Delos Wed Apr 13, 2005 5:25 pm ----------------------------------- The page consists of more than a picture. (In case you're wondering, he's the guy that made NotPron.) Check out the [url=http://forums.gameservers.net/forumdisplay.php?s=eaa83ef9f4d5f8b68ee7d94f7ecc5906&forumid=527]forums if you need more help.